معلومة

تلف الحمض النووي بوساطة النسخ

تلف الحمض النووي بوساطة النسخ


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

أنا أقوم بالبحث في علم الوراثة لسرطان الدماغ ، وأجد عددًا كبيرًا من الطفرات في القنوات ذات الجهد الكهربائي. من المنطقي أن بعضًا من تلف الحمض النووي يرجع إلى نسخ الحمض النووي بكثافة ، أو في شكل كروماتين مفتوح في كثير من الأحيان ، مما يؤدي إلى مزيد من الكسر والضرر بسبب الإجهاد البيئي.

بالطبع ، هذه مجرد تخمينات. لا أحد يعرف أي أوراق بحثية في المنطقة؟


يبدو أن هناك بعض الأدلة القوية على أن النسخ يعزز الطفرة لأن الخيط غير المكتوب قادر على تكوين هياكل ثانوية تعرض القواعد للطفرات الكيميائية.

فيما يلي ورقة بحثية حديثة حول الطفرات المرتبطة بالنسخ:

كيم إتش وآخرون.(2010) يزيد الطفرات المرتبطة بالنسخ تنوع تسلسل البروتين بشكل أكثر فعالية من الطفرات العشوائية في الإشريكية القولونية. بلوس واحد 5 (5): e10567. دوى: 10.1371 / journal.pone.0010567.

من الملخص:

أثناء النسخ ، يصبح خيط الحمض النووي غير المنقوص DNA أحادي السلسلة (ssDNA) ، والذي يمكن أن يشكل هياكل ثانوية. القواعد غير المزدوجة في ssDNA أقل حماية من المطفرات ، وبالتالي تعاني من طفرات أكثر من القواعد المزدوجة. تسمى هذه الطفرات الطفرات المرتبطة بالنسخ. تزداد الطفرات المرتبطة بالنسخ تحت الضغط وتعتمد على تسلسل الحمض النووي. لذلك ، قد يؤثر الاختيار بشكل كبير على تسلسل ترميز البروتين من حيث قابلية التحول المرتبطة بالنسخ لكل حدث نسخ تحت الضغط لتحسين بقاء Escherichia coli.

يستشهد المؤلفون في مقدمتهم بعدد من الأوراق التي توثق الظاهرة التي يمكنك متابعتها. فقط في حال كان التركيز على النظام البكتيري يزعجك ، كيم وآخرون. تم الاستشهاد بالورقة بدورها في:

رايت وآخرون. (2011) أدوار النسخ والسموم الجينية الكامنة وراء طفرات p53 في الجسم الحي. التسرطن 32: 1559-1567

الملخص بالكامل:

يؤدي النسخ إلى الالتفاف الفائق الذي يشكل ويثبت الهياكل الثانوية للحمض النووي أحادي الجديلة (ss) مع حلقات تعرض قواعد G و C القابلة للتغيير جوهريًا والمعرضة للتفاعلات المائية غير الأنزيمية. نظرًا لأن العديد من الدراسات في بدائيات النوى أظهرت ارتباطًا مباشرًا بين ترددات النسخ والطفرة ، فقد أجرينا تحليلات سيليكو باستخدام برنامج الكمبيوتر ، mfg ، الذي يحاكي النسخ ويتنبأ بموقع القواعد المتغيرة المعروفة في حلقات من الهياكل الثانوية عالية الاستقرار. تنبأت تحليلات Mfg للجين الكابت للورم p53 بموقع القواعد المتغيرة وترددات الطفرات المرتبطة بمدى تعرض هذه القواعد المتغيرة في الهياكل الثانوية. أكدت التحليلات في المختبر الآن أن القواعد الـ 12 الأكثر قابلية للتغيير في p53 تقع في الواقع في حلقات ssDNA المتوقعة لهذه الهياكل. تشير البيانات إلى أن السموم الجينية لها تأثيران مستقلان على الطفرات وحدوث السرطان: أولاً ، تقوم بتنشيط نسخ p53 ، مما يزيد من عدد القواعد القابلة للتغيير المكشوفة ويزيد أيضًا من تكرار الطفرات. ثانيًا ، تزيد السموم الجينية من تواتر تحولات G-to-T مما يؤدي إلى انخفاض في طفرات G-to-A و C. هذا التحول التعويضي الدقيق في "مصير" الطفرات G ليس له أي تأثير على وتيرة الطفرات. علاوة على ذلك ، فهو يتماشى مع آليتنا المقترحة للطفرات التي يكون فيها تكرار التعرض لـ G في ssDNA عبر النسخ يحد من معدل تكرار الطفرات في الجسم الحي.


نحن نقبل بشكل عام فكرة أن التكرار يكرر بأمانة المادة الجينية. في الوقت نفسه ، لن يكون التطور ممكنًا بدون طفرة ، والطفرة غير ممكنة بدون بعض العواقب السلبية على الأقل.

طفرات السلالة الجرثومية هي وراثية. عندما تكون موجودة في واحد ، ولكن بشكل خاص في كلا أليلين الجين ، يمكن أن تؤدي هذه الطفرات إلى مرض وراثي (على سبيل المثال ، مرض تاي ساش ورسكووس ، والتليف الكيسي ، والهيموفيليا ، وفقر الدم المنجلي ، وما إلى ذلك). بدلاً من التسبب في المرض ، قد تؤدي بعض طفرات السلالة الجرثومية إلى زيادة احتمالية من الإصابة بالمرض (على سبيل المثال ، الطفرات في جين BRCA2 تزيد بشكل كبير من احتمالات إصابة المرأة بسرطان الثدي). الطفرات الجسدية في الخلايا المنقسمة بنشاط قد يؤدي إلى أورام حميدة و ldquocyst و rdquo أو خبيثة (مثل السرطان). قد تلعب الطفرات الجسدية الأخرى دورًا في الخرف (مرض الزهايمر ومرض الرسكوس) أو في بعض الأمراض العصبية على طول طيف التوحد.

نظرًا لأن الكيمياء المعقدة للنسخ المتماثل تخضع لمعدل خطأ مرتفع متأصل ، فقد طورت الخلايا أنظمة إصلاح الحمض النووي للبقاء على قيد الحياة معدلات الطفرات العالية. كما رأينا ، تتمتع بوليمرات الحمض النووي نفسها بقدرة على التدقيق اللغوي بحيث يمكن إزالة القواعد التي تم إدخالها بشكل غير صحيح واستبدالها بسرعة. علاوة على ذلك ، تطورت آليات متعددة لإصلاح أزواج القواعد غير المتطابقة وأنواع أخرى من الحمض النووي التالف الذي يفلت من الاكتشاف المبكر. إن عدد المرات والمكان الذي يحدث فيه تلف الحمض النووي هو أمر عشوائي ، كما هو الحال بالنسبة للضرر الذي سيتم إصلاحه والذي سيهرب ليصبح طفرة. بالنسبة لأولئك الذين يعانون من العواقب الوخيمة للطفرة غير المعالجة ، والتوازن بين الحمض النووي المحتفظ به وإصلاحه ، فإن الضرر هو أقل ما يقال ، غير كامل. ومع ذلك ، فإن التطور واستمرار الحياة نفسها يعتمدان على هذا التوازن.


تلف الحمض النووي

يعاني جميع الحمض النووي من التلف بمرور الوقت ، من التعرض للأشعة فوق البنفسجية والأشعة الأخرى ، وكذلك من المواد الكيميائية المختلفة في البيئة (الشكلان 7.34 و 7.35). حتى التفاعلات الكيميائية التي تحدث بشكل طبيعي داخل الخلايا يمكن أن تؤدي إلى ظهور مركبات يمكن أن تدمر الحمض النووي. كما تعلم بالفعل ، حتى التغييرات الطفيفة في تسلسل الحمض النووي ، مثل الطفرات النقطية ، يمكن أن يكون لها أحيانًا عواقب بعيدة المدى. وبالمثل ، فإن الضرر غير المُصلح الناجم عن الإشعاع أو المواد الكيميائية البيئية أو حتى الكيمياء الخلوية العادية يمكن أن يتداخل مع النقل الدقيق للمعلومات في الحمض النووي. يعد الحفاظ على سلامة الخلية & quotblueprint & quot أمرًا ذا أهمية حيوية وينعكس ذلك في الآليات العديدة الموجودة لإصلاح الأخطاء والتلف في الحمض النووي.

الشكل 7.34 - فواصل الكروموسوم - ويكيبيديا الشكل 7.35 - الحمض النووي المفرد (العلوي) والمزدوج (السفلي) التالف - ويكيبيديا


استجابة تلف الحمض النووي

الحفاظ على سلامة الجينوم والإخلاص أمر ضروري للوظيفة المناسبة والبقاء على قيد الحياة لجميع الكائنات الحية. هذه المهمة شاقة بشكل خاص بسبب الاعتداء المستمر على الحمض النووي من قبل العوامل السامة للجينات (الداخلية والخارجية على حد سواء) ، وإساءة دمج النوكليوتيدات أثناء تكرار الحمض النووي ، وعدم الاستقرار الكيميائي الحيوي الجوهري للحمض النووي نفسه. 1

قد يؤدي الفشل في إصلاح آفات الحمض النووي إلى انسداد النسخ والتكرار ، والطفرات ، و / أو السمية الخلوية. 2 في البشر ، ثبت أن تلف الحمض النووي له دور في مجموعة متنوعة من الاضطرابات الموروثة جينيًا ، في الشيخوخة ، 3 وفي التسرطن. 4 ، 5


عرض صورة أكبر
شكل 1. استجابة تلف الحمض النووي. ينتج تلف الحمض النووي عن مجموعة متنوعة من المصادر. قد تتضمن الاستجابة الخلوية للضرر تنشيط نقطة تفتيش دورة الخلية ، أو بدء برامج النسخ ، أو تنفيذ إصلاح الحمض النووي ، أو عندما يكون الضرر شديدًا ، بدء موت الخلايا المبرمج.

طورت جميع الخلايا حقيقية النواة استجابة متعددة الأوجه لمواجهة الآثار الضارة المحتملة لتلف الحمض النووي (الشكل 1). 2 عند استشعار تلف الحمض النووي أو توقف التكاثر ، يتم تنشيط نقاط فحص دورة الخلية لإيقاف تقدم دورة الخلية لإتاحة الوقت للإصلاح قبل انتقال الضرر إلى الخلايا الوليدة. بالإضافة إلى تنشيط نقطة التفتيش ، تؤدي استجابة تلف الحمض النووي إلى تحريض برامج النسخ ، وتعزيز مسارات إصلاح الحمض النووي ، وعندما يكون مستوى الضرر شديدًا ، إلى بدء موت الخلايا المبرمج. 6 يتم تنسيق كل هذه العمليات بعناية بحيث يتم الحفاظ على المادة الجينية وتكرارها وفصلها بأمانة داخل الخلية.

نقاط فحص دورة الخلية

نقاط تفتيش دورة الخلية هي مسارات تنظيمية تحكم ترتيب وتوقيت انتقالات دورة الخلية لضمان إكمال حدث خلوي واحد قبل بدء حدث آخر. المنظمون الرئيسيون لمسارات نقاط التفتيش في استجابة تلف الحمض النووي للثدييات هي ATM (رنح توسع الشعريات ، المتحور) و ATR (ATM و Rad3) كينازات البروتين. ينتمي كل من هذين البروتينين إلى عائلة فريدة هيكليًا من كينازات سيرين-ثريونين التي تتميز بعنصر تحفيزي طرفي C يحتوي على مجال فوسفاتيديلينوسيتول 3-كيناز. 7 ، 8 على الرغم من أن أجهزة الصراف الآلي و ATR تبدو وكأنها تؤدي إلى فسفرة العديد من الركائز الخلوية نفسها ، 9 فإنها تستجيب عمومًا لأنواع مميزة من تلف الحمض النووي. ATM هو الوسيط الأساسي للاستجابة لانكسارات الحمض النووي المزدوجة (DSBs) التي يمكن أن تنشأ عن طريق التعرض للإشعاع المؤين (IR). من ناحية أخرى ، يلعب ATR دورًا احتياطيًا فقط في استجابة DSB ، ولكنه يوجه الاستجابة الأساسية لتلف الأشعة فوق البنفسجية وتوقف تكرار الحمض النووي.


عرض صورة أكبر
الشكل 2. مسارات نقاط تفتيش دورة خلية الثدييات. استجابةً لتلف الحمض النووي ، تؤدي أجهزة الصراف الآلي و / أو ATR إلى تنشيط نقطة تفتيش تؤدي إلى توقف دورة الخلية أو تأخيرها. تتميز مسارات نقاط التفتيش بسلسلة من أحداث فسفرة البروتين (يشار إليها بحرف "P") التي تغير نشاط البروتينات المعدلة أو ثباتها أو توطينها. يشار إلى نظرة عامة عامة على مسارات نقاط تفتيش دورة الخلية G1 و S و G2 (اللوحات اليسرى والوسطى واليمنى ، على التوالي). انظر النص الرئيسي لمزيد من التفاصيل.

نقطة تفتيش G1

تمنع نقطة تفتيش دورة الخلية G1 تكرار الحمض النووي التالف وهي أفضل نقطة تفتيش مفهومة في خلايا الثدييات (الشكل 2). 10 من الأمور المركزية لنقطة التفتيش هذه تراكم وتنشيط البروتين p53 ، وهما خاصيتان يتم التحكم فيهما بعناية بواسطة أجهزة الصراف الآلي و ATR kinases. في الخلايا التي تنمو بشكل طبيعي ، تكون مستويات p53 منخفضة بسبب التفاعل مع MDM2 ، الذي يستهدف p53 للتصدير النووي والتحلل بوساطة البروتينات في السيتوبلازم. 11 بعد تلف الأشعة تحت الحمراء ، تقوم أجهزة الصراف الآلي بتنشيط كيناز Chk2 المصب (عن طريق الفسفرة في الموضع T68) ، 12 والذي بدوره يؤدي إلى الفسفرة المتبقية S20 من p53. الفسفرة S20 لل p53 كتل التفاعل p53 / MDM2 ، مما أدى إلى تراكم p53. تمارس أجهزة الصراف الآلي مقياس تحكم ثانٍ على استقرار p53 عن طريق فسفرة المنظم السلبي p53 ، MDM2 ، على S395. 13 يسمح هذا التعديل بتفاعل MDM2 / p53 ، ولكنه يمنع تصدير p53 النووي إلى السيتوبلازم حيث يحدث التدهور عادةً. دور ATR في الفسفرة p53 S20 (والتثبيت اللاحق) أقل رسوخًا ، ولكنه ضمني من خلال في المختبر دليل يوضح فسفرة S20 بواسطة كيناز المعتمد على ATR ، Chk1. 14

في حين أن الفسفرة لـ S20 مهمة لاستقرار p53 ، فإن فسفرة S15 تبدو حاسمة في تعزيز نشاط معاملات النسخ p53. 15 يمكن فسفرة بقايا S15 من p53 مباشرة بواسطة ATM أو ATR استجابةً للأشعة فوق البنفسجية (ATM و ATR) والإشعاع فوق البنفسجي (ATR) وأكشاك شوكات تكرار الحمض النووي (ATR). ينظم p53 المنشط بعد ذلك عددًا من الجينات المستهدفة ، يشارك العديد منها أيضًا في استجابة تلف الحمض النووي (MDM2 و GADD45a و p21 / Cip). يؤدي تراكم p21 ، وهو مثبط للكيناز المعتمد على السيكلين ، إلى تثبيط نشاط Cyclin E / Cdk2 kinase مما يؤدي إلى توقف G1 (انظر المرجع 10 والمراجع فيه).

حاجز S- المرحلة

تراقب نقطة تفتيش المرحلة S تقدم دورة الخلية وتقلل من معدل تخليق الحمض النووي بعد تلف الحمض النووي. على الرغم من أن هذا المسار هو الأقل فهمًا لنقاط التفتيش الخاصة بالثدييات ، إلا أن الدراسات الحديثة حول تنشيط نقطة تفتيش المرحلة S المستحثة بالأشعة تحت الحمراء بدأت في تقديم رؤية مهمة. تفشل الخلايا المأخوذة من الأفراد المعرضين للسرطان المتأثرين برنح توسع الشعريات (AT) أو متلازمة كسر نيميجن (NBS) في إبطاء معدل تكرار الحمض النووي بعد التعرض للأشعة تحت الحمراء ، وهي ظاهرة تُعرف باسم تخليق الحمض النووي المقاوم للراديو (RDS). تشير هذه النتيجة إلى المنتجات الجينية المرتبطة (ATM و NBS1 ، على التوالي) في مسار نقطة تفتيش المرحلة S. تشير الأدلة التجريبية إلى أن تلف الأشعة تحت الحمراء ينشط نقطة تفتيش المرحلة S عبر فرعين متوازيين على الأقل ، وكلاهما ينظمهما أجهزة الصراف الآلي. 16 ، 17 ، 18 في الفرع الأول ، يؤدي تلف الأشعة تحت الحمراء إلى الفسفرة في Chk2 kinase (عند T68) بواسطة أجهزة الصراف الآلي. يستهدف 19 Chk2 ، بمجرد تنشيطه ، إنزيم Cdc25A الفوسفاتيز للتحلل المعتمد على اليوبيكويتين عن طريق فسفرته على S123. 19 يؤدي عدم استقرار Cdc25A الناتج إلى منعه من أداء وظيفته الطبيعية المتمثلة في إزالة الفسفرة المثبطة (T14 و Y15) من Cdk2. تظل مجمعات Cdk2 / Cyclin E و Cdk2 / Cyclin A غير نشطة وبالتالي تمنع اكتمال تخليق الحمض النووي.

الفرع الثاني من مسار نقطة تفتيش المرحلة S الناجم عن الأشعة تحت الحمراء مستقل عن Cdc25A ، ولكنه يتطلب أنشطة كل من ATM و NBS1. 16 ، 17 ، 18 عند تلف الأشعة تحت الحمراء ، فسفرة أجهزة الصراف الآلي عددًا من ركائز المصب بما في ذلك NBS1 (في مواقع متعددة بما في ذلك S343) ، منتج الجين 1 للإصابة بسرطان الثدي (BRCA1 في مواقع متعددة بما في ذلك S1387) ، و SMC1 (الصيانة الهيكلية لـ بروتين كروموسوم 1 في S957 و S966). يؤدي فقدان أي من هذه البروتينات أو حدوث طفرة في مواقع الفسفرة المشار إليها إلى تنشيط نقطة تفتيش S-phase الموهنة. 16 ، 17 ، 18 ، 20 ومن المثير للاهتمام ، أن بروتينات NBS1 و BRCA1 مطلوبة من أجل الفسفرة المثلى لـ SMC1 عند الأشعة تحت الحمراء ، 17 ، 18 ربما مما يشير إلى أنه يجب تكوين مجمع بروتين أكبر قبل أن تتمكن أجهزة الصراف الآلي من الفسفرة SMC1. في الواقع ، تم إثبات أن بروتينات ATM و NBS1 و BRCA1 جميعها جزء من مركب بروتين ضخم بحجم دالتون يُشار إليه باسم BASC (مجمع مراقبة الجينوم المرتبط بـ BRCA1) والذي يتضمن أيضًا العديد من عوامل إصلاح الحمض النووي وتكرارها. 21 لا يزال يتعين توضيح الأدوار الدقيقة لهذه البروتينات والتفاصيل الآلية لكيفية تنشيط هذا الفرع من نقطة تفتيش المرحلة S إلى تقليل تخليق الحمض النووي.

كما تظل مشاركة ATR في نقطة تفتيش S-phase غامضة نسبيًا. لقد ثبت أن ATR يبدأ استجابة بطيئة لنقطة تفتيش المرحلة S المستحثة بالأشعة تحت الحمراء عن طريق فسفرة كيناز المستجيب الخاص به ، Chk1 (في S317 و S345) ، والذي بدوره يؤدي إلى فسفرة Cdc25A التي تستهدفه للتحلل. 22 بالإضافة إلى ذلك ، يخضع SMC1 للفسفرة S957 و S966 عند التشعيع بالأشعة فوق البنفسجية أو معالجة هيدروكسي يوريا بطريقة مستقلة عن أجهزة الصراف الآلي. 18 إن الاستجابة المثبتة لـ ATR للأضرار فوق البنفسجية وكتل النسخ تجعلها المشتبه به الرئيسي في فسفرة SMC1 في ظل هذه الظروف ، ومع ذلك ، لا يوجد دليل تجريبي. علاوة على ذلك ، تم الإبلاغ عن مسار نقطة تفتيش إضافية على شكل S موجه من ATR للتعامل مع أضرار الأشعة فوق البنفسجية وأخطاء النسخ المتماثل. 7

نقطة تفتيش G2

نقطة تفتيش دورة خلية G2 هي إجراء تحكم مهم يسمح بتعليق دورة الخلية قبل فصل الكروموسوم. يتم التحكم في الدخول إلى الانقسام الفتيلي بواسطة نشاط كيناز Cdc2 المعتمد على سايكلين. 23 تعد صيانة الفسفرة المثبطة على Cdc2 (في T14 و Y15) أمرًا ضروريًا لتنشيط نقطة تفتيش G2. يعدل ATM و ATR بشكل غير مباشر حالة الفسفرة لهذه المواقع استجابة لتلف الحمض النووي. على عكس نقاط التفتيش الأخرى ، يتم التوسط في الاستجابة للأشعة تحت الحمراء بشكل أساسي بواسطة ATR 24 حيث تلعب أجهزة الصراف الآلي دورًا احتياطيًا ، حيث يتم التحكم في الاستجابة للأضرار الناتجة عن الأشعة فوق البنفسجية وكتل النسخ المتماثل بواسطة ATR. وتجدر الإشارة إلى أن مرحلة دورة الخلية عند حدوث تلف الحمض النووي قد تؤثر على ما إذا كانت الاستجابة تتم بوساطة ATR أو ATM. 7 في أي حال ، عند تلف الحمض النووي ، فإن كينازات المصب Chk1 و Chk2 (التي يتم تنشيطها بواسطة الفسفرة المعتمدة على ATR و ATM ، على التوالي) تعمل على فسفرة الفوسفاتيز ثنائي الخصوصية Cdc25C في الموضع S216. 25 تؤدي عملية الفسفرة لهذه المادة المتبقية إلى إنشاء موقع ربط لبروتينات 14-3-3. يتم عزل مجمعات البروتين 14-3-3 / Cdc25C في السيتوبلازم ، وبالتالي منع Cdc25C من تنشيط Cdc2 من خلال إزالة الفسفرة المثبطة T14 و Y15. ينتج عن هذا الحفاظ على مجمع Cdc2 / Cyclin B1 في حالته غير النشطة وعرقلة الدخول في الانقسام الفتيلي.

مسارات إصلاح الحمض النووي

الانعكاس المباشر تتضمن أبسط مسارات إصلاح الحمض النووي البشري الانعكاس المباشر لآفة الألكلة شديدة الطفرة O 6 -methylguanine (O 6 -mG) بواسطة منتج جين MGMT (O 6 -methylguanine DNA methyltransferase). 26 يتم إنشاء معقد O 6 -mG في مستويات منخفضة عن طريق تفاعل الهدم الخلوي مع بقايا الجوانين في الحمض النووي. يحدث تصحيح الآفة عن طريق النقل المباشر لمجموعة الألكيل على الجوانين إلى بقايا السيستين في الموقع النشط لـ MGMT في تفاعل "انتحاري". ثم يتحلل بروتين alkyl-MGMT المعطل في مسار يوبيكويتين الحال للبروتين المعتمد على ATP. 28 إن آلية الإصلاح باهظة الثمن هذه لتصحيح مقارب ألكيل بسيط نسبيًا تشير إلى أن O 6 -mG ضار للغاية بالخلية. وفقًا لذلك ، تم تطوير عدد من عوامل العلاج الكيميائي التي تهاجم موضع O 6 من الجوانين وهي قيد الاستخدام السريري. 29

BER إصلاح الاستئصال الأساسي (BER) هو عملية متعددة الخطوات تصحح الأضرار غير الضخمة للقواعد الناتجة عن الأكسدة أو المثيلة أو نزع الأمين أو الفقد التلقائي لقاعدة الحمض النووي نفسها. 30 هذه التعديلات ، على الرغم من بساطتها في طبيعتها ، مطفرة للغاية وبالتالي تمثل تهديدًا كبيرًا لأمانة الجينوم واستقراره. 2


عرض صورة أكبر
الشكل 3. إصلاح استئصال القاعدة (BER). الموضح هو نموذج عام لمسار التصحيح القصير (على اليسار) والرقعة الطويلة (على اليمين) BER. يستبدل إصلاح الرقعة القصيرة الآفة بإصلاح رقعة طويلة من النيوكليوتيدات يستبدل الآفة بحوالي 2 إلى 10 نيوكليوتيدات. انظر النص الرئيسي لمزيد من التفاصيل.

يحتوي BER على مسارين فرعيين (الشكل 3) ، كلاهما يبدأ بفعل جليكوزيلاز الحمض النووي الذي يشق الرابطة N-glycosidic بين القاعدة التالفة والعمود الفقري لفوسفات السكر في الحمض النووي. ينتج عن هذا الانقسام موقع أبريميدين / أبورينيك (AP) أو موقع أباسي في الحمض النووي. تم التعرف على ثمانية إنزيمات جليكوزيلات الحمض النووي ذات خصوصية تداخل قاعدية متداخلة جزئيًا في البشر. بدلاً من ذلك ، يمكن أن تنشأ مواقع AP أيضًا عن طريق التحلل المائي التلقائي للرابطة N- glycosidic. في كلتا الحالتين ، تتم معالجة موقع AP لاحقًا بواسطة AP Endonuclease 1 (APE1) الذي يشق العمود الفقري للفوسفودايستر على الفور 5 'إلى موقع AP ، مما ينتج عنه 3' مجموعة هيدروكسيل وفوسفات ديوكسيريبوز عابر 5 '(dRP). يمكن أن تتم إزالة dRP عن طريق عمل DNA polymerase beta (Pol b) ، والذي يضيف نيوكليوتيد واحد إلى 3 'نهاية النك ويزيل جزء dRP من خلال نشاط لياز AP ​​المرتبط به. 32 يتم ختم النك الخيطي أخيرًا بواسطة DNA ligase ، وبالتالي استعادة سلامة الحمض النووي. يشار إلى استبدال القاعدة التالفة بنوكليوتيد جديد واحد كما هو موصوف أعلاه بإصلاح "التصحيح القصير" ويمثل ما يقرب من 80-90٪ من إجمالي معدل الخطأ في البتات (BER).

يتم استخدام المسار الاحتياطي لـ BER ، والذي يُطلق عليه إصلاح "التصحيح الطويل" ، عند وجود قاعدة معدلة مقاومة لنشاط AP lyase الخاص بـ DNA Pol beta في الحمض النووي. 33 ينتج عن إصلاح البقع الطويلة استبدال ما يقرب من 2-10 نيوكليوتيدات بما في ذلك القاعدة التالفة. يتطلب هذا المسار الفرعي العديد من نفس العوامل المشاركة في إصلاح الرقعة القصيرة ، بما في ذلك DNA glycosylase و APE1 و DNA Pol beta. على عكس إصلاح الرقعة القصيرة ، فإن إصلاح الرقعة الطويلة هو مسار يعتمد على PCNA ، 34 حيث يضيف بوليميراز الحمض النووي (بيتا د ، زيتا إبسيلون) عدة نيوكليوتيدات إلى فجوة الإصلاح وبالتالي إزاحة dRP كجزء من "رفرف" قليل النوكليوتيد. يتم استئصال نتوء قليل النوكليوتيد الناتج عن طريق نوكلياز رفرف FEN-1 قبل ختم النك بواسطة ليجاز DNA.

NER ربما يكون إصلاح ختان النوكليوتيدات (NER) هو أكثر مسارات إصلاح الحمض النووي مرونة مع الأخذ في الاعتبار تنوع آفات الحمض النووي التي يعمل عليها. أهم هذه الآفات هي ثنائيات البيريميدين (ثنائيات سيكلوبوتان بيريميدين و6-4 منتجات ضوئية) الناتجة عن مكون الأشعة فوق البنفسجية لأشعة الشمس. تشتمل ركائز NER الأخرى على مقاربات كيميائية ضخمة ، وروابط متقاطعة داخل الحمض النووي ، وبعض أشكال الضرر التأكسدي. تتمثل السمات المشتركة للآفات التي يتعرف عليها مسار NER في أنها تسبب تشوهًا حلزونيًا لمزدوج الحمض النووي وتعديل كيمياء الحمض النووي. 35

تم الحصول على نظرة ثاقبة لعملية NER البشري من خلال دراسة اثنين من الاضطرابات الجسدية المتنحية النادرة ، ولكن غير متجانسة - جفاف الجلد المصطبغ (XP) ومتلازمة كوكايين (CS). الأفراد المصابون بأي من هذه الأمراض تظهر عليهم حساسية شديدة من الأشعة فوق البنفسجية. كلا المرضين غير متجانس وراثيا يحدث XP بسبب طفرات في واحد من سبعة جينات (XPA إلى XPG) و CS ناتج عن عيوب في واحد من اثنين من الجينات (CSA أو CSB). من المعروف الآن أن منتجات جينات XP تؤدي وظائف مختلفة أثناء التعرف على الضرر وشق الحمض النووي. 36 ، من ناحية أخرى ، فإن المنتجات الجينية CS مطلوبة للإصلاح المستند إلى NER للجينات النشطة نسبيًا. 37


عرض صورة أكبر
الشكل 4. إصلاح ختان النوكليوتيدات (NER). يتم عرض نموذج مبسط للخطوات في NER. يختلف التعرف على تلف الحمض النووي (1) بين الجينوم العالمي والنسخ المقترن NER (GG- و TC-NER ، على التوالي). تتم مشاركة الخطوات اللاحقة لهذه العمليات وتشمل الفك المحلي للحمض النووي (2) والشق المزدوج لشق الحمض النووي (3) وتركيب إصلاح الحمض النووي وربط الخيوط (4). انظر النص الرئيسي لمزيد من التفاصيل.

تتطلب عملية NER عمل أكثر من 30 بروتينًا بطريقة متدرجة تتضمن التعرف على الضرر ، والفتح الموضعي للحمض النووي المزدوج حول الآفة ، والشق المزدوج لشريط الحمض النووي التالف ، وتركيب إصلاح الفجوة ، وربط الخيوط (الشكل 4). 38 كما أشير أعلاه ، هناك شكلين متميزين من NER: NER الجينومي العالمي (GG-NER) ، الذي يصحح الضرر في المناطق الصامتة نسبيًا من الجينوم ، والنسخ المقترن NER (TC-NER) ، الذي يصلح الآفات على النسخ النشطة. حبلا من الحمض النووي. هذان المساران الفرعيان متطابقان بشكل أساسي باستثناء آلية التعرف على الضرر. في GG-NER ، يكون مجمع البروتين XPC / HHR23B مسؤولاً عن الاكتشاف الأولي للحمض النووي التالف. على العكس من ذلك ، لا يتطلب التعرف على الضرر أثناء TC-NER استخدام XPC ، ولكن يُعتقد أنه يحدث عندما تتوقف آلية النسخ في موقع الإصابة. يجب بعد ذلك إزاحة مركب بوليميراز RNA المتوقف للسماح لبروتينات NER بالوصول إلى الحمض النووي التالف. يتم دعم هذا الإزاحة من خلال عمل بروتينات CSA و CSB ، بالإضافة إلى عوامل أخرى خاصة بـ TC-NER. تسير الخطوات اللاحقة لـ GG- و TC-NER بطريقة متطابقة بشكل أساسي. يرتبط XPA وبروتين النسخ المتماثل A (RPA) في موقع الإصابة ويساعدان في التعرف على الضرر. بعد ذلك ، فإن مروحيات XPB و XPD ، مكونات عامل النسخ متعدد الوحدات TFIIH ، تزيل ازدواج الحمض النووي في المنطقة المجاورة مباشرة للآفة. ثم يشق نوكلياز XPG و ERCC1 / XPF خيطًا واحدًا من الحمض النووي في الموضعين 3 'و 5' للضرر ، على التوالي ، مما يولد ما يقرب من 30 أليغنوكليوتيد قاعدي يحتوي على الآفة. يتم إزاحة قليل النيوكليوتيد هذا ، مما يفسح المجال لتخليق إصلاح الفجوة (الذي يقوم به DNA Pol delta epsilon ، بالإضافة إلى العديد من عوامل التكرار الإضافية). أخيرًا ، يتم ختم النك الموجود في الشريط الذي تم إصلاحه بواسطة DNA ligase ، وبالتالي يتم إكمال عملية NER.

معدل وفيات الأمهات يلعب مسار إصلاح عدم تطابق الحمض النووي (MMR) دورًا أساسيًا في تصحيح أخطاء النسخ المتماثل مثل عدم تطابق القاعدة الأساسية وحلقات الإدراج / الحذف (IDLs) التي تنتج عن التضمين الخاطئ لبوليميراز الحمض النووي للنيوكليوتيدات وانزلاق القالب ، على التوالي. يتم أيضًا تصحيح Mispairs الناتج عن نزع الأمينات التلقائي لـ 5-methylcytosine و heteroduplexes بعد إعادة التركيب الجيني عبر MMR. تؤدي العيوب في هذا المسار إلى ما يسمى بالنمط الظاهري الخلوي "المتحور" الذي يتميز بترددات مرتفعة في الطفرات التلقائية وزيادة عدم استقرار الأقمار الصناعية الدقيقة (MSI). تؤدي الطفرات في العديد من جينات MMR البشرية إلى الاستعداد للإصابة بسرطان القولون والمستقيم الوراثي (HNPCC) ، بالإضافة إلى مجموعة متنوعة من الأورام المتفرقة التي تظهر MSI. 5

تشبه العملية الكلية لـ MMR مسارات إصلاح الختان الأخرى (انظر BER طويل التصحيح ، و NER) ، حيث يتم التعرف على آفة الحمض النووي (عدم التطابق أو IDL) ، ويتم استئصال الرقعة التي تحتوي على الآفة ، ويتم تصحيح الخصلة عن طريق تركيب إصلاح الحمض النووي وإعادة الربط (الشكل 5). 39 يبدأ مسار MMR للثدييات من خلال التعرف على عدم التطابق أو IDL بواسطة مغاير مغاير لبروتينات MSH2-MSH6 (المعروفة باسم MutS alpha beta). يتم توفير عدم تطابق القاعدة السائد ونشاط التعرف على IDL أحادي القاعدة في الخلايا البشرية بواسطة MutS alpha 40 IDLs الأكبر عادةً بواسطة MutS beta. ومع ذلك ، هناك بعض التداخل الجزئي في خصوصية الركيزة بواسطة هذين المعيارين المتغارين مما يشير على الأقل إلى الحد الأدنى من التكرار في التعرف على الركيزة من خلال مسار MMR. 40 بعد تحديد الآفة ، يربط MutS alpha beta) ATP ، ويخضع لتحول توافقي ، وينتقل على طول الحمض النووي بعيدًا عن موقع الآفة حتى تتم مصادفة بروتينات MMR الإضافية. يتم تكوين مجمعات بروتينية عالية المستوى 41 ، 42 ، بما في ذلك تلك التي تحتوي على البروتينات غير المتجانسة لـ MLH1-PMS2 (MutL alpha beta) ، MLH1-MLH3 ، وعوامل النسخ المتماثل. يُعتقد أن تمييز السلك يحدث عن طريق ملامسة بروتين MMR مع آلية النسخ المتماثل. 43 يتم توفير دعم هذه الفرضية من خلال اكتشاف أن MutL alpha يمكن أن تتفاعل مع عامل ملحق النسخ ، PCNA. 44 قد يوفر هذا التفاعل رابطًا ماديًا بين التعرف على عدم التطابق وتحديد حبلا الحمض النووي المركب حديثًا عند شوكة النسخ المتماثل. يتم إجراء استئصال وإعادة تركيب الخيط الناشئ (الذي يحتوي على عدم التطابق أو IDL) بواسطة عدد من العوامل بما في ذلك PCNA و RPA و RFC و exonuclease I و DNA polymerases delta و epsilon و endonuclease FEN1 وعوامل إضافية. 43


عرض صورة أكبر
الشكل 5. إصلاح عدم التطابق (MMR). تم عرض نموذج لـ MMR للثدييات. يبدأ معدل وفيات الأمهات من خلال التعرف على عدم التطابق والتمييز بين الخيوط. بعد استئصال الخيط المركب حديثًا الذي يحتوي على القاعدة غير المتطابقة أو حلقة الإدراج / الحذف (IDL) ، يتم إجراء إعادة تركيب الخيط لاستعادة دقة الحمض النووي.

إصلاح DSB ربما تكون الفواصل المزدوجة (DSBs) هي أخطر أشكال تلف الحمض النووي لأنها تسبب مشاكل في النسخ والتكرار وفصل الكروموسوم. ينتج الضرر من هذا النوع عن مجموعة متنوعة من المصادر بما في ذلك العوامل الخارجية مثل الإشعاع المؤين وبعض المواد الكيميائية السامة للجينات ، وأنواع الأكسجين التفاعلية المتولدة داخليًا ، وتكرار فواصل الحمض النووي أحادية السلسلة ، والضغط الميكانيكي على الكروموسومات. تختلف DSBs عن معظم الأنواع الأخرى من آفات الحمض النووي من حيث أنها تؤثر على كل من خيوط الحمض النووي المزدوج وبالتالي تمنع استخدام الخيط التكميلي كقالب للإصلاح (انظر BER و NER و MMR). يمكن أن يؤدي الفشل في إصلاح هذه العيوب إلى عدم استقرار الكروموسومات مما يؤدي إلى التعبير الجيني غير المنظم والتسرطن. 4 لمواجهة الآثار الضارة لهذه الآفات القوية ، طورت الخلايا مسارين متميزين لإصلاح DSB ، 45 إعادة التركيب المتماثل (HR) والانضمام غير المتماثل (NHEJ) (الشكل 6). القرار الخلوي بشأن المسار الذي يجب استخدامه لإصلاح DSB غير واضح ، ومع ذلك ، يبدو أنه يتأثر إلى حد كبير بالمرحلة داخل دورة الخلية في وقت اكتساب الضرر. 46

يصحح الإصلاح الموجه من الموارد البشرية عيوب DSB بطريقة خالية من الأخطاء باستخدام آلية تسترد المعلومات الجينية من جزيء DNA متماثل غير تالف. تحدث غالبية الإصلاحات المستندة إلى الموارد البشرية في المرحلتين S و G2 المتأخرين من دورة الخلية عندما يتوفر كروماتيد شقيق غير تالف للاستخدام كقالب إصلاح. تتوسط مجموعة البروتينات RAD52 ، بما في ذلك RAD50 و RAD51 و RAD52 و RAD54 و MRE11 ، هذه العملية. 47 يُعتقد أن بروتين RAD52 نفسه هو المستشعر الأولي لنهايات الحمض النووي المكسور. ينتج عن معالجة الأطراف التالفة إنتاج 3 أجزاء من الحمض النووي أحادي الجديلة (ssDNA). ترتبط نهايات ssDNA التي تم إنشاؤها حديثًا بـ RAD51 لتشكيل خيوط بروتين نووي. تعمل البروتينات الأخرى بما في ذلك RPA و RAD52 و RAD54 و BRCA1 و BRCA2 والعديد من البروتينات الإضافية المرتبطة بـ RAD51 كعوامل ملحقة في تجميع الخيوط وأنشطة RAD51 اللاحقة. 45 ثم يبحث خيوط البروتين النووي RAD51 عن الحمض النووي غير التالف الموجود على الكروماتيد الشقيق لقالب إصلاح متماثل. بمجرد تحديد الحمض النووي المتماثل ، يغزو خيط الحمض النووي التالف ثنائي الحمض النووي غير التالف في عملية يشار إليها باسم تبادل خيوط الحمض النووي. ثم يقوم بوليميراز الدنا بتمديد الطرف الثالث للشريط الغازي والربط اللاحق بواسطة DNA Ligase I ينتج بنية DNA متغايرة الانعكاس. يتم حل وسيط إعادة التركيب هذا ويكتمل التصحيح الدقيق والخالي من الأخطاء لـ DSB.


عرض صورة أكبر
الشكل 6. إصلاح كسر حبال مزدوج (DSB). الموضح هو نظرة عامة على الخطوات الرئيسية ومتطلبات العوامل لإصلاح DNA DSB عن طريق إعادة التركيب المتماثل (يسار) والربط النهائي غير المتماثل (يمين). انظر النص الرئيسي للحصول على التفاصيل.

على عكس الموارد البشرية ، لا يتطلب NHEJ نموذجًا متماثلًا لإصلاح DSB وعادةً ما ينتج عنه تصحيح الفاصل بطريقة عرضة للخطأ. يعتبر نشاط البروتين غير المتجانسة Ku70 / Ku80 ضروريًا لمسار NHEJ. 48 يبدأ مغاير Ku NHEJ من خلال الارتباط بنهايات الحمض النووي المجانية وتجنيد عوامل NHEJ الأخرى مثل بروتين كيناز المعتمد على الحمض النووي (DNA-PK) و XRCC4 و DNA Ligase IV إلى موقع الإصابة. 45 يتم تنشيط DNA-PK عند ارتباط الحمض النووي ، ويفسفر عددًا من الركائز بما في ذلك p53 و Ku والعامل المساعد DNA Ligase IV XRCC4. ويعتقد أن الفسفرة لهذه العوامل تزيد من تسهيل عملية الإصلاح. نظرًا لأن نهايات معظم DSBs الناتجة عن العوامل السامة للجينات تالفة ولا يمكن ربطها بشكل مباشر ، فغالبًا ما يتعين عليها الخضوع لمعالجة محدودة بواسطة نوكليازات و / أو بوليميراز قبل أن تتمكن NHEJ من المضي قدمًا. لا يزال يتعين تحديد نوكلياز (ق) المسؤولة عن هذه المعالجة ، لكن المرشحين الأقوياء لهذا النشاط يشملون مجمع MRE11 / Rad50 / NBS1 و 49 و 50 FEN-1 و 51 وبروتين Artemis. تتضمن الخطوة الأخيرة في إصلاح NHEJ ربط نهايات الحمض النووي بواسطة Ligase IV في مجمع يتضمن أيضًا XRCC4 و Ku.


إصلاح ختان القاعدة وإصلاح ختان النوكليوتيدات

يتضمن إصلاح الاستئصال الأساسي (BER) إنزيمات متعددة لاستئصال واستبدال قاعدة نوكليوتيد واحدة تالفة. التعديلات الأساسية التي تم إصلاحها بشكل أساسي بواسطة إنزيمات BER هي تلك التي تضررت من الأكسدة الداخلية والتحلل المائي. يشق جليكوزيلاز الحمض النووي الرابطة بين قاعدة النيوكليوتيدات والريبوز ، تاركًا سلسلة فوسفات الريبوز للحمض النووي سليمة ولكنها تؤدي إلى موقع أبوريني أو أبيريميدين (AP). 8-Oxoguanine DNA glycosylase I (Ogg1) يزيل 7،8-dihydro-8-oxoguanine (8-oxoG) ، إحدى الطفرات الأساسية الناتجة عن أنواع الأكسجين التفاعلية. يرتبط تعدد الأشكال في جين OGG1 البشري بخطر الإصابة بأنواع مختلفة من السرطان مثل سرطان الرئة والبروستاتا. يوراسيل DNA glycosylase ، إنزيم BER آخر ، يستأصل اليوراسيل الذي هو نتاج نزع أمين السيتوزين ، وبالتالي يمنع طفرة نقطة C → T اللاحقة. 15 N-Methylpurine DNA glycosylase (MPG) قادر على إزالة مجموعة متنوعة من قواعد البيورين المعدلة. 16

The AP sites in the DNA that result from the action of BER enzymes, as well as those that result from depyrimidination and depurin ation actions, are repaired by the action of AP-endonuclease 1 (APE1). APE1 cleaves the phosphodiester chain 5’ to the AP site. The DNA strand then contains a 3’-hydroxyl group and a 5’-abasic deoxyribose phosphate. DNA polymerase β (Polβ) inserts the correct nucleotide based on the corresponding W-C pairing and removes the deoxyribose phosphate through its associated AP-lyase activity. The presence of X-ray repair cross-complementing group 1 (XRCC1) is necessary to form a heterodimer with DNA ligase III (LIG3). XRCC1 acts as a scaffold protein to present a non-reactive binding site for Polβ, and bring the Polβ and LIG3 enzymes together at the site of repair. 17 Poly(ADP-ribose) polymerase (PARP-1) interacts with XRCC1 and Polβ and is a necessary component of the BER pathway. 18,19 The final step in the repair is performed by LIG3, which connects the deoxyribose of the replacement nucleotide to the deoxyribosylphosphate backbone. This pathway has been named “short-patch BER”. 20

An alternative pathway called “long-patch BER” replaces a strand of nucleotides with a minimum length of 2 nucleotides. Repair lengths of 10 to 12 nucleotides have been reported. 21,22 Longpatch BER requires the presence of proliferation cell nuclear antigen (PCNA), which acts as a scaffold protein for the restructuring enzymes. 23 Other DNA polymerases, possibly Polδ and Polε, 24 are used to generate an oligonucleotide flap. The existing nucleotide sequence is removed by flap endonuclease-1 (FEN1). The oligonucleotide is then ligated to the DNA by DNA ligase I (LIG1), sealing the break and completing the repair. 17 The process used to determine the selection of short-patch versus long patch BER pathways is still under investigation (الشكل 4). 25

الشكل 4. Schematic of both short-patch and long-patch BER pathways.

While BER may replace multiple nucleotides via the long-patch pathway, the initiating event for both short-patch and long-patch BER is damage to a single nucleotide, resulting in minimal impact on the structure of the DNA double helix. Nucleotide excision repair (NER) repairs damage to a nucleotide strand containing at least 2 bases and creating a structural distortion of the DNA. NER acts to repair single strand breaks in addition to serial damage from exogenous sources such as bulky DNA adducts and UV radiation. 26 The same pathway may be used to repair damage from oxidative stress. 27 Over 20 proteins are involved in the NER pathway in mammalian cells, including XPA, XPC-hHR23B, replication protein A (RPA), transcription factor TFIIH, XPB and XPD DNA helicases, ERCC1-XPF and XPG, Polδ, Polε, PCNA, and replication factor C. 28 Overexpression of the excision repair cross-complementing (ERCC1) gene has been associated with cisplatin resistance by non-small-cell lung cancer cells 29 and corresponds to enhanced DNA repair capacity. 30 Global genomic NER (GGR) repairs damage throughout the genome, while a specific NER pathway called Transcription Coupled Repair (TCR) repairs genes during active RNA polymerase transcription. 31


معلومات الكاتب

الانتماءات

IFOM, The FIRC Institute of Molecular Oncology, Milan, Italy

Fabio Pessina, Ubaldo Gioia, Valerio Vitelli, Alessandro Galbiati, Sara Barozzi, Massimiliano Garre, Amanda Oldani, Dario Parazzoli & Fabrizio d’Adda di Fagagna

Dipartimento di Biotecnologie Mediche e Medicina Traslazionale, Università degli Studi di Milano, Segrate, Italy

Fabio Giavazzi & Roberto Cerbino

Department of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY, USA

Yandong Yin & Eli Rothenberg

Centre for Chromosome Biology, Biochemistry, School of Natural Sciences, National University of Ireland, Galway, Ireland

Istituto di Genetica Molecolare, CNR—Consiglio Nazionale delle Ricerche, Pavia, Italy

Fabrizio d’Adda di Fagagna

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

يمكنك أيضًا البحث عن هذا المؤلف في PubMed Google Scholar

مساهمات

F.G. conceived and performed all of the LLPS analyses of 53BP1 foci. Y.Y. performed all of the STORM experiments. U.G., together with M.G., performed timelapse experiments of 53BP1 foci treated with NH4OAc and 1,6-hexanediol, and performed comet assays and the EJ5 repair assays. V.V. conceived and performed strand-specific RT–qPCR and qPCR analysis of ChIP experiments and dilncRNA detection both in cells and in vitro. A.G. conceived and performed DIPLA analysis. S.B. performed all of the microinjections in cells and all of the 53BP1 droplets detection experiments in vitro. م. performed all of the timelapse experiments assisted by U.G. F.P. performed all of the FRAP experiments and confocal analysis of 53BP1 focus formation. A.O. performed all of the quantifications of confocal images. A.F. supervised F.P. for the in vitro system and nucleosome preparation and edited the manuscript. أر. advised F.G. and edited the manuscript. D.P. supervised S.B., M.G. and A.O. and advised them on all of the imaging experiments. E.R. supervised Y.Y. and edited the manuscript. F.P. designed and performed all of the remaining experiments and wrote the manuscript. F.d’A.d.F. conceived the study and, together with F.P., assembled and revised the manuscript. All of the authors commented on the manuscript.

المؤلف المراسل


النتائج

RCC1 overexpression accelerates the cell cycle

The cellular concentration of free Ran⋅GTP available for binding to NTRs is critical for most known Ran-regulated functions, including NCT. To determine changes in Ran regulation that could lead to increased Ran⋅GTP levels, we applied computational modeling of the minimal set of proteins controlling the GTP/GDP cycle on Ran. Within these models, we either increased or decreased the concentrations of their individual components and followed the changes of average cellular Ran⋅GTP concentration (Gorlich وآخرون., 2003 Caudron وآخرون., 2005 Kalab وآخرون.، 2006). The NCT rates for all Ran system components are not known. Therefore we used the previously published single-compartment models of mitotic HeLa cells (Caudron وآخرون., 2005 Kalab وآخرون., 2006) to simulate the Ran system in rapidly dividing mitotic cells with high Ran⋅GTP levels (Hasegawa وآخرون., 2013 Figure 1B). From the relative expression in HeLa and human fibroblasts (HFF-1 Supplemental Figure S1), we deduced the composition of the Ran system in slowly dividing cells (Hasegawa وآخرون., 2013 Figure 1A, Supplemental Figure S1, Supplemental Text S1, and Supplemental Tables S1 and S2). In both models, Ran⋅GTP levels were most responsive to simultaneous changes in Ran and RCC1 concentrations and reduced RanGAP1 expression (Figure 1, A and B). When overexpression of individual factors was considered, Ran⋅GTP was most sensitive to RCC1 concentration in the fibroblast model (Figure 1A) and to changes in Ran in the HeLa model (Figure 1B). Therefore, to examine how increased Ran⋅GTP levels affect the cell cycle in relatively slowly dividing cells, we tested RCC1 overexpression.

FIGURE 1: RCC1-dependent increase in Ran⋅GTP accelerates the cell cycle. (A and B) Changes in cellular Ran⋅GTP concentration analyzed by computational models of the minimal Ran system in a fibroblast-like cell (A) and a HeLa-like cell (B). (C) Immunoblots of RCC1 in the hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cell lysates. (D) Schematic of the RBP-4 FRET sensor for Ran⋅GTP detection with FLIM. The binding of Ran⋅GTP to RBP-4 increases the donor–acceptor distance, resulting in a longer donor fluorescence lifetime, τdonor. (E) Detection of mitotic Ran⋅GTP gradients in hTERT-RPE1 WT and hTERT-ΔRPE1 RCC1-V5 cells, using FLIM with RBP-4. The top row shows the donor intensity images and the bottom row shows the pseudocolor FLIM images. The range of the displayed values (corresponding to τdonor values) is indicated beneath the FLIM panels. شريط النطاق: 10 ميكرومتر. (F) Scatter plot of the mitotic Ran⋅GTP gradients quantified as the difference between the cytoplasmic and chromatin E in each cell (ΔE single-cell data means ± SD ر اختبار). (G) Scatter plot of the inverse of the average cellular RBP-4 E, which is proportional to Ran⋅GTP concentration (E −1 single-cell data means ± SD ر اختبار). (H) Cell number in cultures of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells grown in parallel. Means ± SD from two experiments performed in triplicate were fitted with exponential growth equations after 2 d from the start of culture (dashed lines) to calculate the PDT. The null hypothesis was tested: one curve for both data sets.

We chose the telomerase-immortalized normal epithelial RPE1 cells (hTERT-RPE1 WT ) as a model, because these cells display intermediate mitotic Ran⋅GTP gradients and Ran⋅GTP levels (Hasegawa وآخرون.، 2013). Because the models predicted that the effect of RCC1 on Ran⋅GTP would saturate at low micromolar RCC1 concentrations (Supplemental Figure S1), we selected human phosphoglycerate kinase (PGK) promoter to drive moderate overexpression of RCC1 with a C-terminal V5 tag in a stable hTERT-RPE1 RCC1-V5 cell line. From immunoblots (Figure 1C), we estimated that the total RCC1 concentration in the hTERT-RPE1 RCC1-V5 cells was four to six times higher than in the hTERT-RPE1 WT cells. Such an increase in RCC1 levels was similar to the difference between HFF-1 and HeLa cells (Figure 1, A and B, and Supplemental Figure S1), suggesting that the RCC1 overexpression mimicked the physiologically relevant range. We then verified the effect of RCC1 overexpression using RBP-4, the Förster resonance energy transfer (FRET) biosensor for Ran⋅GTP in mitotic cells (Hasegawa وآخرون.، 2013). RBP-4 consists of a Ran⋅GTP-binding domain flanked by the cyan mTFP-1 donor and a nonfluorescent dsREACh acceptor (Figure 1D Hasegawa وآخرون.، 2013). RBP-4 binding to Ran⋅GTP extends the donor from the acceptor, leading to decreased FRET efficiency (E RBP-4 ) and increased donor fluorescence lifetime (τdonor). Because the RBP-4 FRET activity decreases with Ran⋅GTP binding, the average (E RBP-4 ) −1 value could be used to compare the Ran⋅GTP concentration between different mitotic cells quantitatively (Hasegawa وآخرون.، 2013). We applied fluorescence lifetime imaging microscopy (FLIM) to detect the changes of E RBP-4 in live mitotic cells transiently expressing the RBP-4 sensor. The mitotic hTERT-RPE1 RCC1-V5 cells displayed larger differences in E RBP-4 between the chromatin and cytoplasmic areas (Figure 1F) and higher (E RBP-4 ) −1 values (Figure 1G), confirming the expected increased mitotic Ran⋅GTP gradients and elevated Ran⋅GTP levels. The compartmentalization of Ran and its regulators RCC1 and RanGAP1 between the nucleus and cytoplasm precludes the direct measurements of Ran⋅GTP with RBP-4 FRET in interphase cells. However, previous studies showed that the expression of Ran, RCC1, and RanGAP1 remained stable during the exit from mitosis (Ciciarello وآخرون., 2010), indicating that the mitotic Ran⋅GTP levels correspond to the Ran⋅GTP-generating activity in the interphase cells as well. Fluorescence-activated cell sorting (FACS) analysis showed that the fraction of cells in different cell cycle phases was not appreciably affected by RCC1 overexpression (Supplemental Figure S1). However, consistent with our initial hypothesis, the hTERT-RPE1 RCC1-V5 cells proliferated significantly faster than the WT cells (Figure 1H population doubling time [PDT] = 2.9 vs. 4.5 d).

Ran⋅GTP levels decline in nondividing cells

If the RCC1-dependent rise of Ran⋅GTP activates cell cycle progression, stimuli inducing cell cycle arrest should oppose RCC1 by lowering its activity or expression. To test this scenario, we induced cell cycle arrest in HFF-1 fibroblasts by a long-term in vitro culture or by inducing DNA damage through treatment with doxorubicin (Chang وآخرون., 2002 Sliwinska وآخرون.، 2009). Both replicative exhaustion and doxorubicin treatment induced the onset of cell senescence, as indicated by the appearance of the senescence-associated β-galactosidase (SABG) staining (Debacq-Chainiaux وآخرون., 2009 Figure 2C) and led to a strong decline in RCC1 expression (Figure 2B). We also observed lower Ran and RanBP1 levels in senescent HFF-1 cells and a decrease in RCC1 levels in doxorubicin-treated Wi-38 and CRL-1474 primary human fibroblasts (Supplemental Figure S2). Quantification of immunoblots showed that, when normalized to the total cell protein concentration, the senescent HFF-1 cells contained ∼25% RCC1 compared with early-passage cells (Figure 2B). However, because of their nearly three-times larger volume (1.27 ± 0.07 pl, passage 8 vs. 3.57 ± 0.30 pl, passage 30 HFF-1 fibroblasts), the late-passage cells contained <10% RCC1 concentration compared with the early-passage cells, confirming the strong reduction in the RCC1-dependent Ran⋅GTP generation in nondividing cells.

FIGURE 2: RCC1 expression declines during cell cycle arrest. (A) Immunoblotting of total cell lysates of HFF-1 cells harvested from early (p 8) or late (p 30) passages of in vitro culture and of early-passage HFF-1 cells recovering from the treatment with doxorubicin. (B) Relative tubulin-normalized RCC1 protein expression in HFF-1 cells treated as in A (ن = 3 means ± SD). (C) Micrographs of HFF-1 cells treated as in A and B and stained for the SABG. شريط النطاق: 100 ميكرومتر.

RCC1 overexpression inhibits cell senescence

The cell cycle–promoting activity of RCC1 (Figure 1) indicated that increased RCC1 expression could attenuate DNA damage–induced cell cycle arrest. To test this idea, we compared the responses of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells to doxorubicin treatment. Within the first 2–4 d after doxorubicin washout, most cells stopped dividing in both cultures, as indicated by the disappearance of interphase and mitotic markers (MCM2, Rad51, p-histone H3 [Ser-10] [pS10H3]). At the same time, the increase in cyclin D1 indicated cell cycle arrest (Figure 3A), and the appearance of the SABG signal marked the onset of senescence (Figure 3B). The cyclin D1 levels remained stable, and SABG positivity increased over time in the hTERT-RPE1 WT cells (Figure 3B). In contrast, SABG-negative and proliferating cells gradually prevailed in the hTERT-RPE1 RCC1-V5 cultures (Figure 3B, arrows), concomitant with increased interphase and mitotic markers and the decline in cyclin D1 expression (Figure 3A). The quantitative capillary immunoblotting (Simple Western) analysis confirmed that, 8 d after doxorubicin treatment, hTERT-RPE1 WT cells accumulated cyclin D1, while hTERT-RPE1 RCC1-V5 cells resumed expression of cyclin B1 (Supplemental Figure S3). As in the senescing fibroblasts (Supplemental Figure S2), the expression of Ran decreased to ∼65% in doxorubicin-treated hTERT-RPE1 WT cells (Figure 3A). In contrast, Ran levels slightly increased in the hTERT-RPE1 RCC1-V5 cells exposed to doxorubicin, indicating that RCC1 expression supported Ran stability in cells exposed to DNA damage (Figure 3A). Two months after the doxorubicin treatment, the hTERT-RPE1 RCC1-V5 cells regained normal proliferation, while virtually no dividing cells were detectable in the hTERT-RPE1 WT cell cultures (Figure 3B). To monitor the progress of DNA damage repair, we used immunofluorescence (IF) to quantify the 53BP1 nuclear foci that assemble at the sites of DNA double-strand break repair (Ciccia and Elledge, 2010). Most of the hTERT-RPE1 RCC1-V5 cells had <5 nuclear foci after 8 d of recovery, and mitotic cells were already detectable (Figure 3C). In contrast, the nuclear 53BP1 foci persisted in nearly all doxorubicin-treated hTERT-RPE1 WT cells (Figure 3C). At the same time, 53BP1 strongly accumulated in the cytoplasm of the hTERT-RPE1 WT cells (Figure 3D), indicating delays in the 53BP1 nuclear import, which is Ran⋅GTP- and importin β–dependent (Moudry وآخرون., 2012). It is possible that delays in nuclear import of cargoes other than 53BP1 limited the rate of DNA repair in the WT cells. However, these results strongly suggest that RCC1-dependent activation of NCT contributed to the efficient DNA damage repair and cell cycle reentry in the hTERT-RPE1 RCC1-V5 cells. We observed similar differences in the response of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells to γ-irradiation–induced DNA damage (Supplemental Figure S4), showing that the effects of RCC1 overexpression in doxorubicin-treated cells did not depend on accelerated drug efflux.

FIGURE 3: RCC1 overexpression inhibits DNA damage–induced cell senescence in normal epithelial cells. (A) Immunoblotting of total lysates from the hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells recovering from doxorubicin treatment, showing the resumed expression of the cell cycle markers in the hTERT-RPE1 RCC1-V5 cells. (B) Micrographs of cells treated as in A and stained for SABG. شريط النطاق: 100 ميكرومتر. Arrows indicate dividing cells. (C) IF micrographs of γH2AX and 53BP1 staining in hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells recovering from doxorubicin. The arrow indicates a dividing cell. شريط النطاق: 10 ميكرومتر. (D) Scatter plot of the cytoplasmic/nuclear ratios of the 53BP1 IF signal at 8 d of recovery from the doxorubicin. Individual cell data means ± SD ر test representative of two experiments. (E) Column graph showing fractions of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells that contained the indicated numbers of 53BP1 foci per nucleus during the recovery from doxorubicin treatment. Means ± SD from two independent experiments, adjusted ص values from two-way analysis of variance (ANOVA) with Sidak’s multiple comparison tests.

RCC1 promotes doxorubicin resistance in colorectal carcinoma cells

Because the overexpression of RCC1 prevented the onset of DNA damage–induced cell senescence in normal cells (Figure 3 and Supplemental Figure S4), RCC1 could play a role in cancer cell resistance to DNA damage. Consistent with this idea, the expression of RCC1 was found to be activated by a superenhancer element in colorectal carcinoma HCT116 cells (Hnisz وآخرون., 2013), which is a well-studied model of resistance to DNA damage–inducing chemotherapy (Chang وآخرون., 2002 Sliwinska وآخرون.، 2009). We used several approaches to test the role of RCC1 in HCT116 cells.

First, we compared the effects of doxorubicin on HCT116 WT and an HCT116 RCC1-V5 cell line that stably expressed V5-tagged RCC1 (Figure 4). As previously reported (Chang وآخرون., 2002 Sliwinska وآخرون., 2009) the doxorubicin-treated HCT116 WT cells initially stopped dividing, increased in size, and became SABG-positive (Figure 4A). Small, rapidly dividing, and SABG-negative cells prevailed in the cultures 5–7 d later (Figure 4A, arrows). A transient peak in cyclin D1 expression and a decline in S and G2/M markers (MCM2, pS10H3 Figure 4B, left) indicated a temporary cell cycle arrest. The phenotypic changes induced by doxorubicin in the HCT116 RCC1-V5 cells were similar to those seen in the HCT116 WT cells. However, the shorter duration of cyclin D1 expression and earlier recovery of the S and G2/M markers indicated that the overexpressed RCC1 slightly accelerated cell cycle reentry after DNA damage in the HCT116 RCC1-V5 cell line (Figure 4B).

FIGURE 4: Endogenous RCC1 expression inhibits DNA damage–induced cell senescence in HCT116 colorectal carcinoma cells. (A) Micrographs of HCT116 WT cells recovering from doxorubicin and stained for the SABG. شريط النطاق: 100 ميكرومتر. Arrows indicate SABG activity–free cells. (B) Immunoblotting of total lysates from HCT116 WT and HCT116 RCC1-V5 cells recovering from doxorubicin treatment. (C) Scatter plot of the fractions of colony-forming HCT116 WT and HCT116 RCC-V5 cells recovering from doxorubicin. Single-culture data means ± SD from three experiments performed in triplicate ر اختبار. (D) Immunoblotting of total lysates of HCT116 WT cells treated with control scramble or RCC1-directed RNAi. (E) Scatter plot of the fractions of colony-forming HCT116 WT cells treated with doxorubicin, followed by control or Ran-directed RNAi. Single-culture data means ± SD from two experiments with four replicates each t-test.

We used clonogenic assays to validate the role of RCC1 expression in DNA damage recovery. After doxorubicin treatment, the fraction of colony-forming cells was nearly twice as high in HCT116 RCC1-V5 compared with HCT116 WT cells (Figure 4C), demonstrating that RCC1 overexpression strongly increased cell survival following DNA damage. By analyzing cultures derived from single doxorubicin-treated HCT116 WT cells, we found that rapidly proliferating clones contained RCC1 concentrations similar to the untreated HCT116 cells, in contrast to a slow-proliferating clone (Supplemental Figure S5), indicating that the recovery from DNA damage selects for cells with high RCC1 expression. The requirement for endogenous RCC1 expression in recovery from DNA damage was further confirmed by strongly reduced colony formation in the doxorubicin-treated HCT116 WT cells upon RCC1 knockdown by RNAi (Figure 4E). Based on these results, RCC1 functions as the DNA damage resistance–promoting factor in HCT116 cells, indicating a potential role of RCC1 in tumor cell proliferation in vivo. Indeed, previously reported RNA microarray data sets contained evidence for statistically significantly higher RCC1 expression in ovarian (Scotto وآخرون., 2008), colorectal (Alhopuro وآخرون., 2012), and carboplatin-resistant cervical tumors (Peters وآخرون., 2005), compared with normal tissues (Supplemental Figure S6). Because moderate RCC1 overexpression was sufficient to accelerate cell cycle and DNA damage repair (Figures 1 and 3), relatively small increases in tumor RCC1 could correspond to the activation of Ran pathways restricted to the proliferative fraction of tumor cells.

Ran promotes DNA damage signaling and repair

Apart from accelerating the cell cycle, RCC1 and Ran⋅GTP could support the survival from DNA damage by activating DNA repair. Consistent with the requirement for Ran activity in DNA damage signaling, immunoblotting showed that the knockdown of Ran or RCC1 by RNAi reduced the ATM-dependent phosphorylation of histone H2AX (γH2AX, Ser-139) and KAP1 (Iyengar and Farnham, 2011 p-KAP1, Ser-824) in γ-irradiated hTERT-RPE1 WT cells (Figure 5A). We applied IF in cells that were fixed with paraformaldehyde and co­permeabilized with Triton X-100 to detect changes in the recruitment of 53BP1 to the chromatin, following DNA damage (Jackson and Bartek, 2009). Although the 53BP1 expression was not affected (Figure 5A), both RCC1 and Ran knockdowns significantly reduced the ratio of nuclear 53BP1 and γH2AX signals in the irradiated cells (Figure 5C), indicating defects in 53BP1 association with the DNA damage sites marked by γH2AX signal. The knockdown of Ran had a stronger effect (Figure 5C) and caused the virtual disappearance of 53BP1 foci in a fraction of cells (Figure 5B, arrows). These results indicate that Ran activity is required for the recruitment of 53BP1 to DNA double-strand breaks, which is an essential step for their subsequent repair (Schultz وآخرون., 2000 Callen وآخرون., 2013).

FIGURE 5: Ran-regulated NCT promotes the cellular response to DNA damage. (A) Immunoblotting of total cell lysates of hTERT-RPE1 WT cells treated with control, RCC1-, or Ran-directed RNAi oligos and harvested 1 h after increasing doses of γ-irradiation. Notice the decreased intensity of the p-KAP1 and γH2AX signals in the RCC1 or Ran RNAi-treated cells. (B) IF micrographs of the γ-irradiated (5 Gy) hTERT-RPE1 WT cells showing the reduced 53BP1 recruitment to the chromatin (arrows) upon Ran or RCC1-directed RNAi. (C) Scatter plot of the 53BP1/γH2AX IF signal ratios in cells treated as in B. Individual cell data means ± SD ANOVA with Tukey’s test. (D) IF micrographs of hTERT-RPE1 RCC1-V5 cells pretreated with 40 μM IPZ or 500 nM KPT-330 and fixed 1 h after γ-irradiation (7.5 Gy). The inset shows the p-KAP1 heterochromatin-associated foci (arrow). (E) Immunoblotting of total cell lysates of hTERT-RPE1 WT (top panel) and hTERT-RPE1 RCC1-V5 (bottom) cells treated with 40 μM IPZ or 500 nM KPT-330 and harvested 1 h after increasing doses of γ-irradiation. (F) Quantification of the tubulin-normalized p-KAP1 and γH2AX signals detected on immunoblots of total lysates of cells treated as described and harvested 1 h after the irradiation with 7.5 Gy. Means ± SD from two experiments ANOVA with Tukey’s posttest.

Next we used inhibitors of importin β and exportin 1 to test the role of two major NTRs in DNA damage signaling. To that end, we pretreated cells for 2 h with the exportin 1 inhibitor KPT-330 (Muqbil وآخرون., 2013) or the importin β inhibitor importazole (IPZ Soderholm وآخرون., 2011) and collected samples for IF and immunoblots 1 h after γ-irradiation. IF indicated an increased number of p-KAP1 nuclear foci associated with the heterochromatin in IPZ-treated cells, while KPT-330 treatment had an opposite effect (Figure 5D). Although this trend was reproducible, the frequency of the IPZ-induced p-KAP1 foci varied between experiments. However, consistent with the IF data, immunoblotting showed that treatment with IPZ induced increased p-KAP1 signal upon irradiation, particularly in hTERT-RPE1 RCC1-V5 cells (Figure 5, E and F). Also in agreement with the IF data, KPT-330 caused a strong reduction in p-KAP1 signal and a more moderate decrease in γH2AX signal on immunoblots (Figure 5, E and F). Reciprocal effects of the inhibitors indicate that the interplay between exportin 1– and importin β–regulated NCT modulates the ATM-dependent phosphorylation of KAP1, which has a role in the heterochromatin DNA repair (White وآخرون., 2012).

Because the activation of Ran promotes cell cycle progression (Figure 1), the RNAi knockdowns or inhibitor treatments described above could have induced cell cycle changes that contribute to the observed effects on DNA damage signaling and repair processes. However, the above results demonstrate that, whether directly or also through modulating the cell cycle, the activity of Ran⋅GTP-regulated NCT mechanisms strongly affects essential steps of DDR in cell populations.

RCC1-induced activation of Ran-regulated NCT terminates DDR

The perturbations of DNA damage signaling induced by Ran or RCC1 knockdowns (Figure 5) indicate that the mechanism of RCC1-induced recovery from DNA damage could require high Ran activity during the initial response to the damage. We examined this possibility by manipulating Ran function in cells that already sustained γ-irradiation–induced (10 Gy) DNA damage. First, we followed the irradiation of the hTERT-RPE1 WT cells by transduction with control or RCC1-V5–expressing lentiviruses (Figure 6A). As shown by the strongly reduced expression of S-phase and G2/M markers (MCM2, pS10H3), the majority of irradiated control cells stopped proliferating, as expected. The rise of transiently expressed RCC1-V5 was paralleled by a drop in cyclin D1 levels, and the renewed expression of interphase and mitotic markers (MCM2, pS10H3 Figure 6A), indicating cell cycle reentry. This result showed that the activation of Ran in cells recovering from DNA damage is sufficient to terminate the DDR and enable the continuation of cell proliferation (Figure 5).

FIGURE 6: RCC1-induced activation of NCT promotes the completion of the DNA repair and cell cycle reentry. (A–C) Immunoblots showing the changes of the cell cycle and DDR markers in cells exposed to different treatments after the γ-irradiation (10 Gy). (A) The γ-irradiated hTERT-RPE1 WT cells were transduced with control or RCC1-V5 expressing lentiviruses. (B) The γ-irradiated hTERT-RPE1 RCC1-V5 cells were treated with dimethyl sulfoxide (control) or 500 nM KPT-330. (C) Control or Ran-directed RNAi was applied after the γ-irradiation of the hTERT-RPE1 RCC1-V5 cells. (D) Micrographs of 53BP1 and γH2AX IF staining in the hTERT-RPE1 RCC1-V5 treated as in C. Inset with the enhanced contrast shows the accumulation of the cytoplasmic 53BP1 signal in the Ran RNAi-treated cells (arrows). (E) Scatter plot of the cytoplasmic/nuclear ratios of the 53BP1 IF signal in the control or Ran RNAi-treated cells at 7 d of recovery from the γ-irradiation. Individual cell data means ± SD ر test, representative of two experiments. (F) Fractions of hTERT-RPE1 WT and hTERT-RPE1 RCC1-V5 cells recovering from γ-irradiation that contained the indicated numbers of 53BP1 foci per nucleus. Means ± SD from two independent experiments two-way ANOVA with Bonferroni’s posttest.

To determine whether RCC1-induced DDR termination requires the function of exportin 1, we treated γ-irradiated hTERT-RPE1 RCC1-V5 cells with KPT-330. The untreated hTERT-RPE1 RCC1-V5 cells returned to cell cycle after irradiation, as shown by the expression of MCM2, pS10H3, and cyclin B1 (Figure 6B). KPT-330 treatment robustly reversed these trends and induced the accumulation of cyclin D1, indicating that DDR termination requires exportin 1– dependent nuclear export.

To verify that Ran mediates RCC1-induced DDR termination, we treated irradiated hTERT-RPE1 RCC1-V5 cells with control or Ran-directed RNAi. As expected, RNAi controls resumed the cell cycle, as indicated by increased pS10H3 signal and reexpression of the Chk1 kinase, whose activity is essential for S-phase progression (Toledo وآخرون., 2013 Figure 6C). The treatment with Ran RNAi in hTERT-RPE1 RCC1-V5 cells reduced Ran levels by ∼50% (Figure 6C). However, even the partial reduction in Ran expression induced severe delays in DNA repair, as shown by the persistence of phosphorylated ATM on immunoblots (Figure 6C) and 53BP1 nuclear foci in cells stained for IF (Figure 6D). Cell cycle arrest was also confirmed by continuously low levels of Chk1 and pS10H3 (Figure 6C). Similar to hTERT-RPE1 WT cells treated with doxorubicin (Figure 3), the irradiated and Ran RNAi-treated hTERT-RPE1 RCC1-V5 cells accumulated 53BP1 in the cytoplasm (Figure 6, D and E). Therefore the reduced nuclear import of large molecular cargoes, such as 53BP1, appears to be a hallmark of cells failing to complete DNA repair as a consequence of insufficient Ran activity. In summary, these results demonstrate that RCC1-dependent activation of Ran-regulated nuclear import and export pathways facilitated the termination of DDR and cell cycle reentry.


How does ionizing radiation affect cells?

When ionizing radiation interacts with a cell, several things can happen:

  1. The radiation could pass through the cell without damaging the الحمض النووي.
  2. The radiation could damage the cell’s DNA, but the DNA repairs itself.
  3. The radiation could prevent the DNA from تكرار بشكل صحيح.
  4. The radiation could damage the DNA so badly that the cell dies. هذا يسمي موت الخلايا المبرمج. One dead cell is not a big problem. After all, millions of your cells die every day. But if too many cells die at once, the organism could also die.

المواد والأساليب

Generation of Recombinant Sindbis

The coding regions of p16 (Serrano et al., 1993), p21 (Harper et al., 1993), and p27 (Polyak et al., 1994) were subcloned into the BSTEII site of the DSTEQ12 Sindbis virus vector (Joe et al., 1996) downstream of a double subgenomic Sindbis viral promoter. The coding regions of DN cdk2, 3, 4, and 6 (van den Heuvel and Harlow, 1993) and the single chain ScFv control (R6) cDNA was inserted into the XbaI site of the DSTEQ12 vector. The putative DN forms of the CDKs have been previously reported as inactivating Asp to Asn point mutations in the kinase domain (van den Heuvel and Harlow, 1993). The CAT recombinant viruses were generated previously (Cheng et al., 1996 Levine et al., 1996). FLAG tags (ATGGACTACAAGGACGATGATGACAAA) were introduced at the 3′ end of the coding region of p27, p16, DN Cdk2, DN Cdk3, DN Cdk4, and DN Cdk6. Control non-expressing vectors of the CDK inhibitors were generated by eliminating the initiating codon of each inhibitor and in the case of p16, p21, Cdk3, Cdk4, and Cdk6, introducing a premature stop codon shortly after the second methionine in each coding region (Park et al., 1997ب ). All mutations, deletions, and FLAG tags were introduced by PCR and confirmed by sequencing. Viral particles were generated by in vitro translation and transfection into BHK cells and titered by plaque assay as previously described (Joe et al., 1996).

Culture and Survival Assay of Rat Sympathetic Neurons

Primary cultures of rat sympathetic neurons were obtained from dissociated superior cervical ganglia of postnatal day 1 rats (strain Harlan Sprague Dawley Inc., Indianapolis, IN) as described previously (Park et al., 1996ب ). The cells were plated in 0.5 ml of medium per well in collagen-coated 24-well dishes at a density of 𢏀.5 ganglia/well (�,000 neurons/well). The growth medium was RPMI 1640 medium supplemented with 10% heat-inactivated horse serum (JRH Biosciences, Lenexa, KS) and 60 ng/ml mouse NGF (Sigma Chemical Co., St. Louis, MO). To eliminate non-neuronal cells, a mixture of uridine and 5-fluorodeoxyuridine (10 μM each) were added to the cultures on the following day. 3 d after plating, the neurons were infected with Sindbis virus (plaque-forming units per cell of 1 to 2) in 0.2 ml of RPMI 1640 media containing 2% heat-inactivated horse serum. After 1 h of infection, 0.3 ml of RPMI 1640 medium containing 16% heat-inactivated horse serum was added. The cultures were then treated immediately with 100 μM AraC or left to incubate overnight before UV irradiation (300 J/m 2 ). To achieve the latter, each well containing 200 μl of medium containing NGF was exposed in a Stratolinker (Stratagene, La Jolla, CA). After irradiation, 300 μl of additional medium containing NGF with or without drug was added to each well. At appropriate times, the numbers of viable, phase bright neurons were determined by strip counting as previously described (Rydel and Greene, 1988).

Culture and Survival of Cortical Neurons

Rat cortical neurons were cultured from embryonic day 18 rats as previously described (Friedman et al., 1993). The neurons were plated into 24-well dishes (�,000 cells/well) coated with polylysine in serum-free medium (N2/MEM [1:1] supplemented with 6 mg/ml d -glucose, 100 μg/ml transferrin, 25 μg/ml insulin, 20 nM progesterone, 60 μM putrescine, 30 nM selenium). 1 d after plating, the neurons were infected with virus at a multiplicity of infection of 𢏀.5 and incubated overnight. The medium was then exchanged with serum-free medium supplemented with 10 μM camptothecin where appropriate. At appropriate times of culture under the conditions described in the text, cells were lysed and the numbers of viable cells were evaluated as previously described (Rukenstein et al., 1991). All experimental points are expressed as a percentage of cells plated on day 0 and are reported as mean ± SEM (ن = 3).

تألق مناعي

Sympathetic neurons or cortical neurons were dissociated and cultured, as described above, in 6-well plates at a density of 2 ganglion/well (sympathetic neurons) or 200,000 cells/well (cortical neurons). After various times of infection, neurons were fixed with 100% ethanol for 20 min at �ଌ, blocked with PBS containing 2% horse serum, and incubated with anti-FLAG primary antibody (cat No. IBI3010 [1:20 dilution] Fisher Scientific Co., Pittsburgh, PA) and FITC-conjugated horse anti–mouse secondary antibody (1:50 dilution Vector Labs, Inc., Burlingame, CA).

Western Blot Analyses

Cortical neurons were dissociated and cultured as described above. 24 h after infection, the neurons were harvested in Laemmli buffer and 50 μg of protein were loaded onto SDS–polyacrylamide gels, and then transferred onto nitrocellulose membrane as previously described (Cunningham et al., 1997). Blots were probed with anti-FLAG antibody (10 μg/ml).

Cyclin D1𠄺ssociated Kinase Assay

D1-associated kinase activity was performed as previously described (Matsushime et al., 1994). In brief, cortical neurons were treated for various times with camptothecin (10 μM). The cells were washed twice with cold PBS and harvested in IP buffer as previously described (Matsushime et al., 1994). Cell lysates were then precleared by incubation with 75 μl protein G𠄺garose beads (Sigma Chemical Co.) for 1 h. 1 μg of anticyclin D1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) was then added to 300 μg of cell lysate and incubated for 3 h. As control, lysate containing no antibody was used. 50 μl of protein G beads were then added to the lysates and incubated for 1 h. Washing and kinase assay was performed as previously described (Matsushime et al., 1994). pRb (1 μg Santa Cruz Biotechnology) was used as substrate. pRb was then resolved on a 10% SDS–polyacrylamide gel and incorporation of P 32 was analyzed by autoradiography and densitometry.


مناقشة

In summary, CDK9 along with cyclin T1 (constituting the P-TEFb complex) plays a key role in transcription by allowing RNAPII to facilitate the productive elongation of transcripts. Its roles extend beyond transcriptional elongation with functions in the cell cycle, differentiation, DNA repair, and transcriptional initiation and termination. Detailed structural characterization has revealed a conserved cyclin-dependent phosphor-transfer mechanism across CDKs, with some subtle differences in substrate recognition and cyclin binding for CDK9. P-TEFb activity is regulated by sequestering into an inactive complex and various post-translational modifications. Given its pivotal functions, when CDK9 becomes overactive in many hematological and solid cancers there is a continuous production of short-lived proteins that maintain the survival of cancer cells. This addiction to transcription makes cancer cells highly susceptible to the inhibition of CDK9 relative to non-transformed cells. Understanding the biology and function of CDK9 has advanced dramatically since its discovery in 1994 (13) and this has had a positive impact on the design and the use of specific inhibitors as a potential strategy for the treatment of several diseases. In line with this, several first generation CDK9 inhibitors have been developed and tested in clinical trials mostly in combination with conventional chemotherapeutic agents. Unfortunately, these investigational new drug entities have been hampered by severe adverse effects and to date none of them have made it to clinical approval (Supplementary Table 1).

Nevertheless, the authors predict that future development will be guided by insights into the molecular structure and function of CDK9, which will serve as the driving force for further improvements in the potency and specificity of novel inhibitors. Meanwhile, a more advanced understanding of its biology is likely to pave the way for establishing a sounder basis for the future value of CDK9 inhibitors for cancer therapy. One missing piece of knowledge in the CDK9 puzzle is a full validation of this target for cancer treatment. تجريبي في الجسم الحي validation would be best assessed with CDK9-deficient mice. Unfortunately, knockout of CDK9 or its binding partner cyclin T2, is embryonically fatal to the mouse (245, 246). Designs for future studies might use conditional genetic knockout of the CDK9 or cyclin T1/2 genes in various established cancer models to provide more information about the role of the P-TEFb complex in tumor formation. The use of specific inhibitors of CDK9 as chemical probes may well be applied to finally confirm the outcomes from these sophisticated models. To this end, new hope has arisen in recent years from second generation inhibitors, with their much-improved specificity for CDK9 inhibition (Supplementary Table 1). Overall, a holistic understanding of the underlying CDK9 biology will be a prerequisite to optimizing the use of novel kinase inhibitors as mono and/or adjuvant therapies for the future treatment of various neoplastic disorders.


شاهد الفيديو: كيفية إصلاح أخطاء الحمض النووي المختلفة (ديسمبر 2022).